86
|
Thermo Fisher
forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag Forward Primer Reverse Primer Probe Kcnq1 Rs12296050 Gtgcttagactgtgcccg Gggagaccctgtctcgaa Ctcctgggctcctaacctttcacag, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag/product/Thermo Fisher Average 86 stars, based on 1 article reviews
forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag - by Bioz Stars,
2026-03
86/100 stars
|
Buy from Supplier |
96
|
Illumina Inc
n70x oligo N70x Oligo, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/n70x oligo/product/Illumina Inc Average 96 stars, based on 1 article reviews
n70x oligo - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
90
|
Qiagen
forward and reverse primers Forward And Reverse Primers, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward and reverse primers/product/Qiagen Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Biomics Biotechnologies
forward and reverse primers Forward And Reverse Primers, supplied by Biomics Biotechnologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward and reverse primers/product/Biomics Biotechnologies Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Eton Bioscience
cox7c qpcr primer: reverseactgaaaacggcaaattctt Cox7c Qpcr Primer: Reverseactgaaaacggcaaattctt, supplied by Eton Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cox7c qpcr primer: reverseactgaaaacggcaaattctt/product/Eton Bioscience Average 90 stars, based on 1 article reviews
cox7c qpcr primer: reverseactgaaaacggcaaattctt - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Midland Certified Reagent
forward and reverse primers Forward And Reverse Primers, supplied by Midland Certified Reagent, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward and reverse primers/product/Midland Certified Reagent Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Jackson Laboratory
primer name nucleotide sequence (5′ → 3′) product size reference gfap-cre oimr1084 oimr1085 gcggtctggcagtaaaaactatc gtgaaacagcattgctgtcactt Primer Name Nucleotide Sequence (5′ → 3′) Product Size Reference Gfap Cre Oimr1084 Oimr1085 Gcggtctggcagtaaaaactatc Gtgaaacagcattgctgtcactt, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer name nucleotide sequence (5′ → 3′) product size reference gfap-cre oimr1084 oimr1085 gcggtctggcagtaaaaactatc gtgaaacagcattgctgtcactt/product/Jackson Laboratory Average 90 stars, based on 1 article reviews
primer name nucleotide sequence (5′ → 3′) product size reference gfap-cre oimr1084 oimr1085 gcggtctggcagtaaaaactatc gtgaaacagcattgctgtcactt - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Eurofins
il-6–3′utr stem-loop (sl) oligonucleotide Il 6–3′Utr Stem Loop (Sl) Oligonucleotide, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/il-6–3′utr stem-loop (sl) oligonucleotide/product/Eurofins Average 90 stars, based on 1 article reviews
il-6–3′utr stem-loop (sl) oligonucleotide - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Bio Basic Canada
forward and reward primers Forward And Reward Primers, supplied by Bio Basic Canada, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward and reward primers/product/Bio Basic Canada Average 90 stars, based on 1 article reviews
forward and reward primers - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Eurofins
forward primer Forward Primer, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward primer/product/Eurofins Average 90 stars, based on 1 article reviews
forward primer - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Sangon Biotech
forward primer 16s-f Forward Primer 16s F, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward primer 16s-f/product/Sangon Biotech Average 90 stars, based on 1 article reviews
forward primer 16s-f - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
GeneWorks
forward and reverse primers Forward And Reverse Primers, supplied by GeneWorks, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward and reverse primers/product/GeneWorks Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |