forward primer Search Results


86
Thermo Fisher forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag
Forward Primer Reverse Primer Probe Kcnq1 Rs12296050 Gtgcttagactgtgcccg Gggagaccctgtctcgaa Ctcctgggctcctaacctttcacag, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag - by Bioz Stars, 2026-03
86/100 stars
  Buy from Supplier

96
Illumina Inc n70x oligo
N70x Oligo, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/n70x oligo/product/Illumina Inc
Average 96 stars, based on 1 article reviews
n70x oligo - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

90
Qiagen forward and reverse primers
Forward And Reverse Primers, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward and reverse primers/product/Qiagen
Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Biomics Biotechnologies forward and reverse primers
Forward And Reverse Primers, supplied by Biomics Biotechnologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward and reverse primers/product/Biomics Biotechnologies
Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Eton Bioscience cox7c qpcr primer: reverseactgaaaacggcaaattctt
Cox7c Qpcr Primer: Reverseactgaaaacggcaaattctt, supplied by Eton Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cox7c qpcr primer: reverseactgaaaacggcaaattctt/product/Eton Bioscience
Average 90 stars, based on 1 article reviews
cox7c qpcr primer: reverseactgaaaacggcaaattctt - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Midland Certified Reagent forward and reverse primers
Forward And Reverse Primers, supplied by Midland Certified Reagent, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward and reverse primers/product/Midland Certified Reagent
Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Jackson Laboratory primer name nucleotide sequence (5′ → 3′) product size reference gfap-cre oimr1084 oimr1085 gcggtctggcagtaaaaactatc gtgaaacagcattgctgtcactt
Primer Name Nucleotide Sequence (5′ → 3′) Product Size Reference Gfap Cre Oimr1084 Oimr1085 Gcggtctggcagtaaaaactatc Gtgaaacagcattgctgtcactt, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer name nucleotide sequence (5′ → 3′) product size reference gfap-cre oimr1084 oimr1085 gcggtctggcagtaaaaactatc gtgaaacagcattgctgtcactt/product/Jackson Laboratory
Average 90 stars, based on 1 article reviews
primer name nucleotide sequence (5′ → 3′) product size reference gfap-cre oimr1084 oimr1085 gcggtctggcagtaaaaactatc gtgaaacagcattgctgtcactt - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Eurofins il-6–3′utr stem-loop (sl) oligonucleotide
Il 6–3′Utr Stem Loop (Sl) Oligonucleotide, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/il-6–3′utr stem-loop (sl) oligonucleotide/product/Eurofins
Average 90 stars, based on 1 article reviews
il-6–3′utr stem-loop (sl) oligonucleotide - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Bio Basic Canada forward and reward primers
Forward And Reward Primers, supplied by Bio Basic Canada, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward and reward primers/product/Bio Basic Canada
Average 90 stars, based on 1 article reviews
forward and reward primers - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Eurofins forward primer
Forward Primer, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward primer/product/Eurofins
Average 90 stars, based on 1 article reviews
forward primer - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Sangon Biotech forward primer 16s-f
Forward Primer 16s F, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward primer 16s-f/product/Sangon Biotech
Average 90 stars, based on 1 article reviews
forward primer 16s-f - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
GeneWorks forward and reverse primers
Forward And Reverse Primers, supplied by GeneWorks, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward and reverse primers/product/GeneWorks
Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results